1 answer

Word ...l 7 25% x 7:10 PM cheg2 DOCX - 12 KB la. In the mRNA...

Question:

Word ...l 7 25% x 7:10 PM cheg2 DOCX - 12 KB la. In the mRNA sequence ACUAGaugСAGAGCUCAUGCACCACCAGAGA, where the lowercase au
Word ...l 7 25% x 7:10 PM cheg2 DOCX - 12 KB la. In the mRNA sequence ACUAGaugСAGAGCUCAUGCACCACCAGAGA, where the lowercase aug is the translation start site, if the underlined A is changed to a U, will it change the encoded protein sequence? Yes No 1b. What if the underlined G is changed to a C? Yes No lc. What if both changes are made? Yes No 3. What is a possible mRNA sequence that could encode the protein sequence M-A-G-Y-N? Explain please. Open Word

Answers

Ans:1(a) If A changes to U in the given mRNA sequence, then instead of serine amino acid there will be Cysteine amino acid because the resulting codon will be UGC (codes for cysteine) instead of earlier AGC (serine). so yes, it will change the resulting protein sequence.

Ans1(b): If G changes to C in the given mRNA sequence, then instead of serine amino acid there will be Threonine amino acid because the resulting codon will be ACC (codes for Threonine ) instead of earlier AGC (serine). so yes, it will change the resulting protein sequence.

Ans 1(c): If both A and G are changed to U and C respectively then it will not affect the encoded protein sequence because the resulting codon will be UCC that also codes for Serine.

Explanation: According to Wobble hypothesis multiple codons are possible for a single amino acid. This is because of less precise binding between the 3rd base of the codon (present on mRNA) and 1st base of anticodon (present on tRNA). Hence AGC and UCC both codes for serine amino acid.

Ans 3: The one possible m-RNA sequence will be 5' AUGGCAUACAAC 3'.

Although some other mRNA sequences will be possible because according to wobble hypothesis different codons may code for the same amino acid. Advanced computational tools provided by bioinformatics are also used for this purpose.

please find the image below for explanation.

- Methionine Start codon NGCA PA Alanine possible GCC codons G C G LGcu G जDA Possible GGC Glycine codons 4GGG LGGU Y Tyrosin

.

Similar Solved Questions

1 answer
Question 11 (1 point) Which of the following is one thing that LinkedIn will NOT allow...
Question 11 (1 point) Which of the following is one thing that LinkedIn will NOT allow you to do? Use a resume builder feature to generate a resume from your profile. Go anonymous so that others cannot tell you looked at their profiles. Import your contacts from Facebook. Turn off activity broadcast...
1 answer
To g e monster RN should be prepared to 55. A new patient has com about...
to g e monster RN should be prepared to 55. A new patient has com about having room, and having FBI agents around who bytok the medications from which group? A Morphine B Antidepressants C. Neuroleptics (antipsychotics) D. Tylenol the this 50. The new patient arrived to the ER 2 hours her an overdos...
1 answer
Calculate the terminal voltage of a 5.9500 V lithium cell in a digital wristwatch that draws...
Calculate the terminal voltage of a 5.9500 V lithium cell in a digital wristwatch that draws 0.4900 mA and the cells internal resistance is 6.9500 Ω. Answer should be in the correct number of sig. figs. ....
1 answer
A 36 year old woman presents with the complaint of dacryorrhea and irritation OS for about...
A 36 year old woman presents with the complaint of dacryorrhea and irritation OS for about 48 hours. She has thick mucous discharge that sticks the lids together overnight. Vision seems fine except for blurring by mucous. She denies trauma or ocular pathology. No symptoms of URI or allergy. She has ...
1 answer
Please help me answer numbers 3 and 4 Calculate the average (mean) concentration for your juice. 0.053 +0.06 059=...
please help me answer numbers 3 and 4 Calculate the average (mean) concentration for your juice. 0.053 +0.06 059= 0.173 -0.0571ddob? Other members of your class analysed differentices than you did. From a group that had a different lise fill in the chart below using their average (mean con for their...
1 answer
What is the slope of the line that passes through #(0,0)# and #(-74, 16)#?
What is the slope of the line that passes through #(0,0)# and #(-74, 16)#?...
1 answer
Milton Company is a chocolate wholesaler. The company presents the following information to the date of...
Milton Company is a chocolate wholesaler. The company presents the following information to the date of April 30: Cash ………………………………………… .. $ 9,000 Accounts receivable ……&hell...
1 answer
A. Detemins ita mmaximum cara weght b. If the carge d ksty of .02 ronaEtetnine sdlones...
a. Detemins ita mmaximum cara weght b. If the carge d ksty of .02 ronaEtetnine sdlones of wood cancan arm a nck has a density of laoyl t as of a Whats voluunu of the wcK b. twhats the masslureight of a cbie muses of the rock?...
1 answer
A forty-eight year-old female has been diagnosed with hypertension and has been started on a medication....
A forty-eight year-old female has been diagnosed with hypertension and has been started on a medication. She asks which lifestyle modification is most effective in lowering BP Which of the following statements by the patient indicates the need for more education? A.Reduce sodium by washing canned ve...
1 answer
26) Calculate the pH during the titration of 25.0 ml of 0.500M HCl with a 0.250M...
26) Calculate the pH during the titration of 25.0 ml of 0.500M HCl with a 0.250M NaOH solution at the following point during the titration. millimoles acid initially 12.5 a) 0.00ml of NaOH added Millimoles base added= 0 millimoles acid left = 12.5 or millimoles of base in excess pH = .30 o b) 15.0 m...
1 answer
Angement 1) Classify each of the following reactions as elimination, substitution, addition or r 2) Classify...
angement 1) Classify each of the following reactions as elimination, substitution, addition or r 2) Classify each of the following sites as electrophilic or nucleophilic...
1 answer
Discuss how following the rights of medications protects patients safety?
Discuss how following the rights of medications protects patients safety?...
1 answer
Over a four-year period, Matt Ewing purchased shares in the Oakmark I Fund. Use the following...
Over a four-year period, Matt Ewing purchased shares in the Oakmark I Fund. Use the following information: Year Investment Amount Price per Share 2013 $ 3,500 $ 59 2014 3,500 37 2015 3,500 34 2016 3,500 48 (a) At the end of four years, what is the total amount invested? ...
1 answer
A positive charge of 4.60 μC is fixed in place. From a distance of 3.00 cm a particle of mass 5.90 g and charge +3.00 μC...
A positive charge of 4.60 μC is fixed in place. From a distance of 3.00 cm a particle of mass 5.90 g and charge +3.00 μC is fired with an initial speed of 62.0 m/s directly toward the fixed charge. How close to the fixed charge does the particle get before it comes to rest and starts traveling...
1 answer
Discuss the merits and problems involved in making an ophthalmic solution isotonic (Consider sterility in your...
Discuss the merits and problems involved in making an ophthalmic solution isotonic (Consider sterility in your discussion)....
1 answer
What is the price of a 4-year, 8.2% coupon rate, $1,000 face value bond that pays...
What is the price of a 4-year, 8.2% coupon rate, $1,000 face value bond that pays interest quarterly if the yield to maturity on similar bonds is 12.3%? The price of the bond is $ . (Round to the nearest cent.)...
1 answer
You are a dental hygienist in a periodontal practice. Mr. O- a 45 year old insurance...
You are a dental hygienist in a periodontal practice. Mr. O- a 45 year old insurance executive- has been referred to the periodontal practice from his general dentist for treatment of chronic periodontitis. Today is his initial appointment with you. Mr. O tells you that there is a history of heart a...
1 answer
What capacitor in series with a 100 Ohm resistor and a 20.0 mH inductor will give...
What capacitor in series with a 100 Ohm resistor and a 20.0 mH inductor will give a resonance frequency of 800 Hz? A series RLC circuit consists of a 99.0 Ohm resistor, a 0.130 H inductor, and a 20.0 muF capacitor. It is attached to a 120 V/60 Hz power line. What is the peak current I? The tuning ci...