Answers
As we know that PyData provides a forum for the international community of users and developers of data analysis tools to share ideas and learn from each other. The global PyData network promotes discussion of best practices, new approaches, and emerging technologies for data management, processing, analytics, and visualization. PyData communities approach data science using many languages, including (but not limited to) Python, Julia, and R.
So the approach of PyData is the more numerical and statistical way to solve the sophisticated problem easily and provide it open-source.
The Integration of PyData and Data Sciences will lead to solve the complex problem very easily and will be very good for the Data Science community and Business running across the world.
I think that this integrated approach will increase and facilitate the adoption of the "R" programming model because PyData solve things more numerical way and it is part NUMfocus group, whom mission is to promote open practices in research, data, and scientific computing by serving as a fiscal sponsor for open source projects and organizing community-driven educational programs.
R is more statistical language in comparison to python, so it will be adopted after the integration of PyData and Data Sciences.
.Similar Solved Questions
1 answer
Assume X is normally distributed with a mean of 7 and a standard deviation of 2....
Assume X is normally distributed with a mean of 7 and a standard deviation of 2. Determine the value for x that solves each of the following Round the answers to 2 decimal places. a) P(X >x) = 0.5 b) P(X > x) = 0.95...
1 answer
The following three factors influenced the slave trade in America: the absence of a steady labor...
The following three factors influenced the slave trade in America: the absence of a steady labor supply, the development of a “cash-crop” like tobacco and cotton, and the lust for profits. TRUE OR FALSE?...
1 answer
"Holding other factors constant, a lower dividend payout ratio raises the growth rate. But the higher...
"Holding other factors constant, a lower dividend payout ratio raises the growth rate. But the higher growth rate does not necessarily increase the stock value." True or false? Select one: a. False b. True...
1 answer
Determine whether or not the field F (x,y,z) = (y4_47, 4x4°+62" - XZ, 12yz +10-xy) is...
Determine whether or not the field F (x,y,z) = (y4_47, 4x4°+62" - XZ, 12yz +10-xy) is conservative. If so, find (x, y, z), a Potential function for Be sure to check your answer! out Form om POP y-plane 20.) for both parts of this problem, the vector field is: < 2x + y, x-2y) & the cor...
1 answer
5. A passenger of mass 85 kg is riding in an elevator while The scale only reads the normal force it exerts on the (Note that 1 b 0.453 kg 4.45 N) a) What standing on a platform scale. does the s...
5. A passenger of mass 85 kg is riding in an elevator while The scale only reads the normal force it exerts on the (Note that 1 b 0.453 kg 4.45 N) a) What standing on a platform scale. does the scale read in pounds (lb) when the elevator is not moving? elevator is moving upward with an acceleration ...
1 answer
Choose the best match for this item: Inherited hemoglobin disorders with decreased production of hemoglobins A....
Choose the best match for this item: Inherited hemoglobin disorders with decreased production of hemoglobins A. Decreased oxygen B. Variant forms of hemoglobin C. Blood hemoglobin level D. Hgb E E.Homozygous F. Hgb F G. CLIA waived H. Hgb A1 I.Thalassemias J. Carrier...
1 answer
Import java.util.LinkedList; public class testprintOut { private static LinkedList[] array; public static void main(String[] args) {...
import java.util.LinkedList; public class testprintOut { private static LinkedList[] array; public static void main(String[] args) { int nelems = 5; array = new LinkedList[nelems]; for (int i = 0; i < nelems; i++) { array[i] = new LinkedList<String>(); } array[0]=["ab"]; System.out....
1 answer
A box of mass 6.2 kg slides 4.8 m down a ramp that is inclined 38...
A box of mass 6.2 kg slides 4.8 m down a ramp that is inclined 38 degrees to the horizontal. What is the velocity of the box right before it hits the ground?...
1 answer
Take P 11 kN. (Figure 1) Part A Determine the normal force at a section passing...
Take P 11 kN. (Figure 1) Part A Determine the normal force at a section passing through point C. Express your answer to three significant figures and include the appropriate units HA NO Value Units Figure 1 of 1 Submit Request Answer Part B Determine the shear force at a section passing through poin...
1 answer
CHEM 2032 ORGANIC CHEMISTRY LAB 1 SUMMER 2018 PRE/POST-TEST REAC 712 NAME 1. What safety Precautions...
CHEM 2032 ORGANIC CHEMISTRY LAB 1 SUMMER 2018 PRE/POST-TEST REAC 712 NAME 1. What safety Precautions must be taken when working with Sulfuric acid (H2S04) and Phosphoric acid (H3PO4)? 2. Briefly explain the following terms: a. Heterolytic bond cleavage b. Dehydration reaction Write the chemical equa...
2 answers
Q2. (12 p) The diagram shows a wire carrying current 11 and a loop carrying current...
Q2. (12 p) The diagram shows a wire carrying current 11 and a loop carrying current 12. Side of the loop has length L. The distance between the wire and left edge of the loop is R1, and the distance between the wire and right edge of the loop is R2. a. What is the magnitude and direction of the magn...
1 answer
The probability of a defective unit in a manufacturing process has a binomial distribution with p...
The probability of a defective unit in a manufacturing process has a binomial distribution with p = 0.03 What is the probability of 2 or more occurences in a sample of 15 units?...
1 answer
(a) Consider a Poisson distribution with probability mass function: еxp(- в)в+ P(X = k) =- k!...
(a) Consider a Poisson distribution with probability mass function: еxp(- в)в+ P(X = k) =- k! which is defined for non-negative values of k. (Note that a numerical value of B is not provided). Find P(X <0). (i) (4 marks) Find P(X > 0). (ii) (4 marks) Find P(5 < X s7). (ii)...
1 answer
The strand below is a piece of DNA coding strand 5' - ACTCCGGGTGAGGTATCAAT - 3' Its...
The strand below is a piece of DNA coding strand 5' - ACTCCGGGTGAGGTATCAAT - 3' Its reading frame is set and it can be seen in the middle of the gene sequence. Write out its mRNA strand sequence....
1 answer
How do you simplify #(\frac { 625\sqrt { 3} } { 1/ 2} )#?
How do you simplify #(\frac { 625\sqrt { 3} } { 1/ 2} )#?...