1 answer

Ment Quay Co. had the following transactions during the current period. une 12 Issued 62,800 shares...

Question:

ment Quay Co. had the following transactions during the current period. une 12 Issued 62,800 shares of S6 par value common stock for cash of $450,200 Palicy
ment Quay Co. had the following transactions during the current period. une 12 Issued 62,800 shares of S6 par value common stock for cash of $450,200 Palicy

Answers

Journal entries

Date Account and explanation debit credit
Mar 2 Organisation fees 28700
Common Stock (4000*6) 24000
Paid in capital in excess of par value-Common Stock 4700
(To record issue common Stock)
June 12 Cash 450200
Common Stock (62800*6) 376800
  Paid in capital in excess of par value-Common Stock 73400
(To record issue common Stock)
July 11 Cash (1975*140) 276500
Preferred stock (1975*110) 217250
   Paid in capital in excess of par value-preferred Stock 59250
(To record preferred stock)
Nov 28 Treasury stock 76500
cash 76500
(To record purchase treasury stock)
.

Similar Solved Questions

1 answer
According to a Pew Research Center study, in May 2011, 31% of all American adults had...
According to a Pew Research Center study, in May 2011, 31% of all American adults had a smart phone (one which the user can use to read email and surf the Internet). A communications professor at a university believes this percentage is higher among community college students. She selects 352 commun...
1 answer
Assume that for a PIC24FJ64GA002 the pin for CN13/RB13 has a pushbutton switch connected to it...
Assume that for a PIC24FJ64GA002 the pin for CN13/RB13 has a pushbutton switch connected to it and the change notification interrupt for RB13 is enabled. For the following code snippet, how many times does the -CNInterrupt ISR execute if the pushbutton is presses and released one time? Assume no swi...
1 answer
A) Consider a point charge q at the center of an imaginary box with side lengths...
a) Consider a point charge q at the center of an imaginary box with side lengths 2a. Explicitly calculate the flux of the electric field through the box and show that it agrees with Gauss's law. b) Suppose the electric field of a point charge q is proportional to 1/r3 instead of 1/r2. Does Gauss...
1 answer
Show me all work for the problem i,ii,iii Exercise 1 (Sample size for estimating the mean)....
show me all work for the problem i,ii,iii Exercise 1 (Sample size for estimating the mean). Let X1,...,x, be i.i.d. samples from some un- known distribution of mean u. Let X and S denote the sample mean and sample variance. Fix a E (0,1) and € >0. (i) Suppose the population distribution i...
1 answer
Consider the boiling point trends for simple molecular compounds that contain only X-H bonds (note: there...
Consider the boiling point trends for simple molecular compounds that contain only X-H bonds (note: there are 2 questions about this graph). +H20 - HF - NH3 - CH4 --HF - HCI - HBr - HI --NH3 - PH3 – AsH3 - SbH +CH - SiH - Gehe - SnH Boiling point (°C) . -175 3 41 Row of non-H atom What doe...
1 answer
Question 2 0/ 25 pts What is the magnitude of the counterclockwise couple (M) to the...
Question 2 0/ 25 pts What is the magnitude of the counterclockwise couple (M) to the nearest 0.1 N-m? The angle is 62.4 P 400 N 40 mm P 400 N -u F1o 3...
1 answer
How do you write 8 7/8 as an improper fraction?
How do you write 8 7/8 as an improper fraction?...
1 answer
What is the purpose, content, mood, style, structure, and who is the audience of CDC's infographic...
What is the purpose, content, mood, style, structure, and who is the audience of CDC's infographic Water Use Around the world?...
1 answer
2. What if the two capacitor of problem 2, are now connected in series and tow...
2. What if the two capacitor of problem 2, are now connected in series and tow a 9.0V battery. Find (a) the equivalent capacitance of the combination, (b) the potential difference across each capacitor, and (c) the charge on each capacitor....
1 answer
Please! expain how you got the andwers. I really wan to know the step. Croy Inc....
Please! expain how you got the andwers. I really wan to know the step. Croy Inc. has the following projected sales for the next five months: Month April Sales in Units 3.540 3,945 4, 620 4, 175 3,910 July August Croy's finished goods inventory policy is to have 50 percent of the next month...
1 answer
The complete name for the following compound is: CH3 H Select one or more Da sec...
The complete name for the following compound is: CH3 H Select one or more Da sec Hexylbenzene Ob. 2 Phenylhexane c. (R)-2-Phenylhexane d. (S)-2-Phenylhexane De Butylmethylphenylmethane...
1 answer
Question 4 0.25 pts 4. The consumer price index (CPI) is 150 in year 1, 156...
Question 4 0.25 pts 4. The consumer price index (CPI) is 150 in year 1, 156 in year 2, and 160 in year 3. What is the inflation rate for year 2? Round to nearest whole percentage. a. 3% b.4% O c.6% O d. 7% Question 5 0.25 pts 5. Which of the following is NOT a cost of inflation? a. unexpected redist...
1 answer
The C-F bond is more polar than the N-F bond, but CF4 molecules are nonpolar and...
The C-F bond is more polar than the N-F bond, but CF4 molecules are nonpolar and NF3 molecules are polar. Explain why....
1 answer
A Gene has this sequence: GCATC TAC GCC ATG AAT AT. Translate all sequences in amino...
A Gene has this sequence: GCATC TAC GCC ATG AAT AT. Translate all sequences in amino acids. What would be the impact of these mutations on the protein? 1) GCATCTACGCGATGAATATT 2) GCATCTACGCCATCAATATT 3) GCATCTACGCCATG TATATT...
1 answer
QUESTION 2 Consider the linear system Ti 0.521 + 21 2 0.5x2 + 13 0.25.13 23...
QUESTION 2 Consider the linear system Ti 0.521 + 21 2 0.5x2 + 13 0.25.13 23 0.2 -1.425 2 whose solution is (0.9,-0.8, 0.7). (a) Determine whether the coefficient matrix is strictly diagonally dominant. (5) (b) Approximate the solution of the system by performing two iterations of the Gauss-Seidel al...
1 answer
1. Two charges, one of 2.50 C and the other of -3.50 C, are placed at...
1. Two charges, one of 2.50 C and the other of -3.50 C, are placed at 0 m and z 0.6 rm respectively. Find the position on the z-axis where the net force on a small charge +g would be zero 2.50 C350 0,600 m...