1 answer

In 1994, Congress passed the DNA Identification Act which authorized the FBI to do 2 things:...

Question:

In 1994, Congress passed the DNA Identification Act which authorized the FBI to do 2 things: (1) create and maintain a nation
In 1994, Congress passed the DNA Identification Act which authorized the FBI to do 2 things: (1) create and maintain a national DNA database, and (2) establish standards for forensic DNA testing. Because the human genome is full of DNA tandem repeats and because they vary in the number of contiguous repeat units, it was decided to use tandem repeats to build the DNA database. In 1996, 13 loci were chosen to be the core short tandem repeats (STR) for CODIS. Combined DNA Index System. Al 13 loci consist of various tetramers, 4-base sequences, which have low mutation rates and follow the laws of probability (the number of times the tetramer repeats is completely random). The power of STR analysis comes from looking at multiple STR loci simultaneously. The more STR regions that are tested, the more discriminating the test becomes. The number of times a tetramer repeats affects the length of the STR. Eoch length is a different "alle". Because different numbers of repeats results in different STR lengths. gol electrophoresis can be used for analysis. Consider the STR on chromosome 7. Its tetramer is "gata" and if repeats anywhere from 5 to 16 times. How many different alleles does it have? The following is a 334-base sequence from chromosome 7 with the STR highlighted. Circle each tetramer. How many repeats are present? What is the probability that a person would inherit this allele? - Is any more or less likely to occur than the others? 1 aatttttgta ttttttttag agacggggtt tcaccatgtt ggtcaggetg actatggagt 61 tattttaagg ttaatatata taaagggtat gatagaacac ttgtcatagt ttagaacgaa 121 ctaacgatag atagatagat agatagatag atagatagat aga tagatag ataga tagat 181 agatagtttttttttatctc actaaatagt ctatagtaaa catttaatta ccaatattto 241 gtgcaattet gtcaatgagg ataaatgtgg aategttata attcttaaga atatatatte 301 cctctgagtttttgatacct cagattttaa ggcc How many copies of this "gata" locus does each human have? (Hint: How many copies of chromosome 7 does a person have?) – __ If this person's other chromosome has 8 repeats, how many bands would be visible after electrophoresis Which fragment length (allele) would end up closest to the well where the DNA was loaded? What is the probability that a person would inherit the second allele? What is the probability that a person would end up with this DNA fingerprint Show your calculation (Hint: Use the rule of multiplication.) Al 13 core STR loci used by the FBI are polymorphic Imaniy allelesl. In fact, each has more than 10 alles. In order to simplify the following calculations, assume that each of the STR loc has exactly 10 alleles. What would be the probability that a person's DNA would match the crime scene evidence for just one STR locus Show your calculation What would be the probability of a suspect's DNA matching all 13 loci? Would you convict him or her of the crime? Explain. 180 Pelab 19: DNA Fingerprinting

Answers

- How many different alleles does it have?

It can repeat anywhere from 5 to 16, that means it has 12 alleles which are the following: 5 repeats, 6 repeats, 7, 8, 9, 10, 11, 12, 13, 14, 15 or 16 repeats.

- Circle each tetramer.

1 aatttttgta ttttttttag agacggggtt tcaccatgtt ggtcaggetg actatggagt 61 tattttaagg ttaatatata taaagggtat gatagaacac ttgtcatagt

- How many repeats are present?

15

- What is the probability that a person would inherit this allele?

This cannot be known. I think your teacher amde a mistake thinking that we could suppose all the alleles have the same probabilities of occurring, but that is wrong, different alleles may have different alleles frequencies, and we cannot know that if we are not given with either genotype frequencies or directly allele frequencies.

But if your teacher is assuming all the alleles have the same frequencies, then this allele occurrance probability is 1/12 = 0.083, or 8.3%

- Is any more or less likely to occur than the others?

Following the same logic from the previous question's discussion, the answer would be: it has the same probability of occurring.

- How many copies of gata locus does each human have?

Each human has 2 copies, because we are diploid organisms.

- How many bands would be visible after electrophoresis?

Two bands, one that runned further in the gel for the 8 gata repeats, and another that runned slower for the 15 repeats.

- Which fragment length would end up closest to the well where the DNA was loaded?

The fragment of 15 repeats in length. That is because electroforesis works by providing a molecular net that will get more easily stuck the larger molecules, while the smaller molecules will pass easier through it reaching larger distances. The 15 repeats allele is bigger, so it will not be able to travel as far as the 8 repeats.

- What is the probability that a person would inherit the second allele?

Okay, again we have a problem here, because we have to assume wrong things about allele frequencies in the populations, but let's keep going with our assumption about equal allelic frequencies.

The probability of inheriting this allele is again 1/12 = 0.083

- What is the probability that a person would end up with this DNA fingerprint?

The probability of 2 events ocurring is the product of multiplying both independent probabilities:

(0.083)(0.083) = 0.006889

- What would be the probability that a person's DNA would match the crime scene evidence for just one STR locus?

Okay, now the probability for each allele would be 1/10 = 0.1, and the fingerprint (both allele copies) would be (0.1)(0.1) = 0.01

- What would be the probability of a suspect's DNA matching all 13 loci?

Now we have to multiply the 13 probabilities of 0.01, that's to say, elevate 0.01 to the 13th potency:

0.0113 = 1x10-24, that is a very low probability

- Would you convict him or her for the crime?

Yes, because that number means only 1 person out of 1,000,000,000,000,000,000,000,000 (24 zeros) has such fingerprint, the probability of conviting an inocent is very very low

.

Similar Solved Questions

1 answer
In the small island nation of Carribeau, there are three economic agents. One is a company...
In the small island nation of Carribeau, there are three economic agents. One is a company that does the fishing: second is a restaurant that makes sushi; and lastly there is the government. The fishing company collects 10 tons of fisb million. The restaurant buys 8 tons of fish as noted before and ...
1 answer
2. Compute the following adjustme pute the following adjustments and record in the attached General Journal:...
2. Compute the following adjustme pute the following adjustments and record in the attached General Journal: b. a. ROBO Company ROBO Company pays its employees every Friday. On Friday, January 4, 2013, the Company paid $3,500 for the 5 days beginning the previous December 31. Prepare the adjusting e...
1 answer
How do you solve # 27^(4x)=9^(x+1 ) #?
How do you solve # 27^(4x)=9^(x+1 ) #?...
1 answer
1 3. A linear model for grade performance of freshmen in college Using the laws of...
1 3. A linear model for grade performance of freshmen in college Using the laws of mean and variance, a) find the mean for the model above was found to be y =x3 - 2 where x=1, 2, 3 b) find the variance for the model above....
1 answer
Constants Part A A 0.170-kg, 52.0-cm-long uniform bar has a small 0.080-kg mass glued to its...
Constants Part A A 0.170-kg, 52.0-cm-long uniform bar has a small 0.080-kg mass glued to its left end and a small 0.145-kg mass glued to the other end. You want to balance this system horizontally on a fulcrum placed just under its center of gravity How far from the left end should the fulcrum be pl...
1 answer
You are a Logistics manager for VKT Corp., and energy extraction and production company. A oil...
You are a Logistics manager for VKT Corp., and energy extraction and production company. A oil well in the company's portfolio is generating 10,000 barrels of crude oil per day in excess o present sale commitments. The crude oil can be sold as is on the commodities markets, or refined and conver...
1 answer
1. Write the OVERALL reaction for this lab. 2. Show the mechanism's steps for this reaction....
1. Write the OVERALL reaction for this lab. 2. Show the mechanism's steps for this reaction. Be sure to include the arrows showing where the electrons are being transferred. 3. What is(are) the intermediates in this mechanism? 4. Which step is the rate determining step? 13 SN1: Synthesis of tert...
1 answer
Draw the skeletal formula and newman projections for following: Look down (2 to C3 bond of...
draw the skeletal formula and newman projections for following: Look down (2 to C3 bond of (28,35, 55)-3,5-dimethylheptan-2-01...
1 answer
Air Plastic 45° A ray of light enters a clear plastic cube as shown. The angle...
Air Plastic 45° A ray of light enters a clear plastic cube as shown. The angle of reflection is 45 degrees, The light speed in the plastic is 2.5 x 108 m/s. What is the angle of refraction?...
1 answer
Rank the bold-faced hydrogens shown in order of increasing acidity from 1 = most acidic to...
Rank the bold-faced hydrogens shown in order of increasing acidity from 1 = most acidic to 3 = least acidic. A B C RC=C H RCH=-H H3C H...
1 answer
Polish people who borrowed their mortgages in Swiss francs: were better off when the Swiss National...
Polish people who borrowed their mortgages in Swiss francs: were better off when the Swiss National Bank dropped its peg against the euro. were not affected when the Swiss National Bank dropped its peg against the euro. were worse off when the Swiss National Bank dropped its peg ag...
1 answer
[Q2 20 points] A and B devices separated by a distance d- 50 m measured in...
[Q2 20 points] A and B devices separated by a distance d- 50 m measured in the reference frame S where they are at rest. The following sequence of events occurs: (K) A sends light signal towards B. (L) As soon as the signal is received by B, B sends a signal back to A. (M) A receives the signal from...
1 answer
Please complete the following programming with clear explanations. Thanks! Homework 1 – Programming with Java: What...
Please complete the following programming with clear explanations. Thanks! Homework 1 – Programming with Java: What This Assignment Is About? Classes (methods and attributes) • Objects Arrays of Primitive Values Arrays of Objects Recursion for and if Statements Selection Sort   ...
1 answer
16. How are the other keys that are not strictly under the network operator's control trusted in LTE? 16. How are the other keys that are not strictly under the network operator's co...
16. How are the other keys that are not strictly under the network operator's control trusted in LTE? 16. How are the other keys that are not strictly under the network operator's control trusted in LTE?...
1 answer
What things i can do to submit a strong application for dental hygiene program
what things i can do to submit a strong application for dental hygiene program...
1 answer
Data are drawn from a bell-shaped distribution with a mean of 100 and a standard deviation...
Data are drawn from a bell-shaped distribution with a mean of 100 and a standard deviation of 4. a) Approximately why percentage of the observations fall between 92 and 108? - b) Approximately what percentage of the observations fall between 88 and 112? - c) Approximately what percentage of the obs...