How many moles of oxygen will occupy 728 ml at 760 mm of Hg and 25...

The controller of Furgee Industries has collected the following monthly expense data for use in analyzing the cost behavior of maintenance costs. Month Total Maintenance Costs Total Machine Hours January $2,670 330 February 3,170 480 March 3,770 630 April 4...

Consider the blowing code snippet Question 4 2 pts 2 pts Canvas XC Question 3 2 pts Consider the following code snippet public class Hypp extends Application public void start (Stage stapelt Button button new lutton("Calculate"); Label label new Label("Total amount dut) > public class...

Hank Itzek manufactures and sells homemade wine, and he wants to develop a standard cost per gallon. The following are required for production of a 50-gallon batch. 2,970 ounces of grape concentrate at $0.04 per ounce 54 pounds of granulated sugar at $0.45 per pound 60 lemons at $0.70 each ...

A group of engineers is building a parabolic satellite dish whose shape will be formed by rotating the curve y = ax? about the y-axis. If the dish is to have a 10-ft diameter and a maximum depth of 3 ft, find the value of a and the surface area S of the dish. (Round the surface area to two decimal p...

2.) Explain why the concentration of Fe(SCN)2+ is equal to the intial concentration of the SCN- for each solution in part A? 3.) also!! thank you!!! :) Post-Lab Questions: A solution is made by mixing 5.00 ml. of 0.00300 M Fe(NO,)s with 4.00 mL. of 0.00300 M KSCN and 3.00 mL. of 1.0 MHNO,. After...

please show all steps and label them and also calculate the b values (1 point) The second order equation 3xy- 4xy + (x2 + 2)y = 0 has a regular singular point at x = 0, and therefore has a series solution y(x) = Σ Cnxhtr NEO The recurrence relation for the coefficients can be written in the fo...

What are two most important fields in the header of IP datagram?...

A. Calculate the ionic strength of an aqueous solution of 0.037 M KCl. B. How will the activity of 0.025 M Ca2+ be impacted by the addition of 0.050 M KCl? In other words will the activity of Ca2+ increase or decrease when KCl is added to pure water? Briefly explain your answer....

if you know 16 otherwise 17 needed B Q16. [12pts Use the figure to the right (labeled A-E) to answer the next questions Q16.1 13pt] Which of the labeled region(s) arose developmentally from the hindbrain? Include the name of the region(s). E D Q16.2 (3pt) Which of the labeled region(s), if damaged, ...

A person with T2 diabetes should aim to control carbohydrates per meal to _____________ choices. 6-7 3-5 1-2 8-9 The type of diabetes that should restrict carb intake at breakfast to no more than 2 choices is: T1 T2 pre-gestational...

2) In a completely inelastic explosion, a 1kg pineapple at rest is blown up into three parts. Two of the pieces, mi me have the same mass of 0.25 kg each. m, has a velocity of 2m/s and a direction 30 degrees below the x-axis. m2 has a velocity of 3m/s with a direction 45 degrees above the x-axis. a)...

Absolute value is always... 1. Positive 2. Non-negative Every fraction is a rational number. True or False? The sum of 2/3 and 5/7 is 7/10. True or False? The quotient of two fractions cannot be a whole number True or False? The set of whole numbers is a subset of the set of rational numbers. True o...

The following facts relate to gift cards sold by Sunbru Coffee Company during 2021. Sunbru's fiscal year ends on December 31. (a.) In October 2021, sold $3,000 of gift cards, and redeemed $500 of those gift cards. (5.) In November 2021 , sold $4,000 of gift cards, and redeemed $1,400 of October ...

Part A Find the current in the kth branch of the circuit in the figure a. (Figure 1) NigGk G1+G2+G3+.+Gk+...+GN igG, igG 2igG 2(G1+G2+G3+... +G+..+GN) Figure 1 of 1 igGk SubmitR Request Answer Part B Complete previous part(s) Provide Feedback...

QUESTION 2 A poisonous gas sensor measures a continuous random variable X. In the presence of toxic gases, hypothesis H1, X is distributed as e 16 x > 0 fx|h1(2|H1) x < 0 When there are no toxic gases present (Hypothesis HO), X is distributed as [x170(0|40) = {* * *23 x 20 x < 0 Find the Ma...

INSTITUTE Week 3 RCK Ltd issues a prospectus inviting the public to subscribe for 90 million ordinary shares of $2.00 each. The terms of the issue are that $1.00 is to be paid on application and the remaining $1.00 within one month of allotment. Applications are received for 108 million shares durin...

Is my answer to my dicussion board correct? did I answer the question asked based on the scenario given to me? * Indicates a required field. * Subject Discussion Board 5 Message For the toolbar, press ALT+F10 (PC) or ALT+FN+F10 (Mac). TTT Arial • 3 (12pt) T. . E 102's As the home health...

How many amino acids are encoded by the following mRNA? 5'GCCACCAUGGGCCAAUUACGAAGGUUUUGCUGA3' The answer given by the book is 8, but I cant figure out why. Thanks!...