Answers
ANSWER: True
EXPLANATION:
Management of the company is responsible, accountable to the stakeholders of the company. The financial performance and financial position of the company is communicated to them via financial statements i.e. balance sheet, income statement, cash flow statement etc
.Similar Solved Questions
1 answer
Folic Acid Inc. has $20 million in earnings, pays $3 million in interest to bondholders, and...
Folic Acid Inc. has $20 million in earnings, pays $3 million in interest to bondholders, and $2 million in dividends to preferred stockholders. What are the common stockholders' residual claims to earnings? (Do not round intermediate calculations. Enter your answer in millions rounded to 2 decim...
1 answer
A life insurance representative believes that the mean age of people who buy their first life...
A life insurance representative believes that the mean age of people who buy their first life insurance plan is less than 35. To test his belief he takes a random sample of 15 customers who have just purchased their first life insurance. Their ages are 42, 43,28, 34, 30, 36, 25, 29, 32, 33, 27, 30, ...
1 answer
The marketing department of Jess! Corporation has submitted the following sales forecast for the upcoming fiscal...
The marketing department of Jess! Corporation has submitted the following sales forecast for the upcoming fiscal year (all sales are on account: th lat Quarter 11,000 2nd 3rd Quarter Quarter 12,000 14,000 Badgeted unit Quarter 13,000 The selling price of the company's product is $18.00 per unit ...
1 answer
1. Find the transfer function. A = C3 - ]. 8 = [0].c = [o 1).D...
1. Find the transfer function. A = C3 - ]. 8 = [0].c = [o 1).D = 2...
1 answer
In a manufacturing company the salary of the sales staff is an example of a period...
In a manufacturing company the salary of the sales staff is an example of a period cost...
1 answer
Attempts: Average: S 5. College admissions Suppose the following graph shows the supply of and demand...
Attempts: Average: S 5. College admissions Suppose the following graph shows the supply of and demand for admission to Louisiana State University, where supply represents the number of student openings and demand represents the number of students who want to attend LSU (i.e., the number of student a...
1 answer
Problem 2- System Classification: Linearity (20pts) Circle all nonlinear terms (if any) in the following differential equations: (assume variables on left are outputs, at right are inputs) y'(t)...
Problem 2- System Classification: Linearity (20pts) Circle all nonlinear terms (if any) in the following differential equations: (assume variables on left are outputs, at right are inputs) y'(t) *,4x, +4x, cos(x2) e. Problem 2- System Classification: Linearity (20pts) Circle all nonlinear terms...
1 answer
N 15. 1 Discuss Kubler-Ross's Theory of death and dying and the evaluation of the theory....
n 15. 1 Discuss Kubler-Ross's Theory of death and dying and the evaluation of the theory. Give your opinion, do you think everyone goes through theses stages?...
1 answer
Describe the process of formation of a clathrin-coated vesicle on the plasma membrane during receptor mediated...
Describe the process of formation of a clathrin-coated vesicle on the plasma membrane during receptor mediated endocytosis....
1 answer
3 Marks Exercise 2: Given the following "sens strand" sequence to the Ubx bomeodomain: 5'-cgaagacgcggccgacagacatacacccgctaccagacgctcgagctgga gaaggagttccacacgaatcattatctgacccgcagacggagaatcgaga...
3 Marks Exercise 2: Given the following "sens strand" sequence to the Ubx bomeodomain: 5'-cgaagacgcggccgacagacatacacccgctaccagacgctcgagctgga gaaggagttccacacgaatcattatctgacccgcagacggagaatcgaga tggcgcacgcgctatgcctgacggagcggcagatcaagatctggttccag aaccggcgaatgaagctgaagaaggagatccag-3 1- Design...
1 answer
Problem 1. Assume that Mars formed from chemical elements that were able to freeze out of...
Problem 1. Assume that Mars formed from chemical elements that were able to freeze out of the cloud of gas around the forming Sun, and that the relative abundances in this frozen-out material was the same as that of solar atmosphere (see belowTable) for Mg, Si, Fe, Na, Al, and Ca. Assume that all el...
1 answer
Dr. Terror has developed a new alloy called Ultranomium. He is testing a bar that is...
Dr. Terror has developed a new alloy called Ultranomium. He is testing a bar that is 1.35 m long and has a mass of 362 g. Using a carbon dioxide infrared laser, he carfully heats the bar from 23.6 °C to 268 °C. Answer the two questions below, using three significant digits. Part A: If the ba...
1 answer
Problem 1. HW PROBLEM 4 Chapter 5. (HW SET5) For the circuit below, what resistor connected...
Problem 1. HW PROBLEM 4 Chapter 5. (HW SET5) For the circuit below, what resistor connected across terminals a-b will absorb maximum power from the circuit? What is that power? 10 kS2 o a CT 120: 40 kΩ 1.c o b...
1 answer
Internal rate of return For the project shown in the following table. B. calculate the internal...
Internal rate of return For the project shown in the following table. B. calculate the internal rate of return (IRR). Then indicate, for the project, the maximum cost of capital that the first could have and still find the IRR acceptable. The project's IRR is %. (Round to two decimal places.) i ...