1 answer

Enter your answer in the provided box. Calculate the molarity of 2.53 x 102 mL of...

Question:

Enter your answer in the provided box. Calculate the molarity of 2.53 x 102 mL of solution containing 15.7 of potassium iodid

Enter your answer in the provided box. Calculate the molarity of 2.53 x 102 mL of solution containing 15.7 of potassium iodide. M potassium iodide

Answers

Augwen: mores of KI = man molosman = 15.79 = 0.0946 mol 166gmort molarity of solution = meleg of KI volume of solution - 0.09

.

Similar Solved Questions

1 answer
A manufacturing company in city A wishes to truck its product to 4 different cities, B, C, D, and E
A manufacturing company in city A wishes to truck its product to 4 different cities, B, C, D, and E. If the cities are all interconnected by roads, how many different route plans can be constructed so that a single truck, starting from A, will visit each city exactly once, then return home?Thank you...
3 answers
A force of 15 n is used to lift a 500-g ball from the ground to...
a force of 15 n is used to lift a 500-g ball from the ground to a height of 1.0 m, when it is let go. what is the speed of the ball when it is let go?...
1 answer
Micron owns 30% of JVT Corp's common shares and has significant influence over JVT's operations. Micron...
Micron owns 30% of JVT Corp's common shares and has significant influence over JVT's operations. Micron receives $6,500 in dividends from JVT. The entry to record receipt of the dividends includes a debit to Cash for $6,500 and a credit to Investment in JVT Shares for $6,500. True or false...
1 answer
In 2000, Ms. Ennis, a head of household, contributed $79,000 in exchange for 790 shares of Seta s...
In 2000, Ms. Ennis, a head of household, contributed $79,000 in exchange for 790 shares of Seta stock. Seta is a qualified small business. This year, Ms. Ennis sold all 790 shares for $119,000. Her only other investment income was an $9,000 long-term capital gain from the sale of land. Her taxable i...
1 answer
Show how to graph please. Graph the function f(t)=3t(h(t−4)−h(t−9)) for 0≤t<∞0≤t<∞. Use your graph to write...
Show how to graph please. Graph the function f(t)=3t(h(t−4)−h(t−9)) for 0≤t<∞0≤t<∞. Use your graph to write this function piecewise as follows: 3t(h(t−4)−h(t−9))={ if 0≤t<4,0≤t<4, if 4≤t<9,4≤t<9, if 9≤t<&i...
1 answer
Question 61 pts Gwendolyn has noticed that every time she eats out on her own she...
Question 61 pts Gwendolyn has noticed that every time she eats out on her own she chooses a pizza place over fast food places that serve burgers and fries. Consequently, Gwendolyn decides she must really prefer pizzas to burgers and fries. In this example, Gwendolyn has formed her attitude in the ma...
1 answer
Word ...l 7 25% x 7:10 PM cheg2 DOCX - 12 KB la. In the mRNA...
Word ...l 7 25% x 7:10 PM cheg2 DOCX - 12 KB la. In the mRNA sequence ACUAGaugСAGAGCUCAUGCACCACCAGAGA, where the lowercase aug is the translation start site, if the underlined A is changed to a U, will it change the encoded protein sequence? Yes No 1b. What if the underlined G is changed to a ...
1 answer
Propose a synthesis mechanism (А) (В) ОН
Propose a synthesis mechanism (А) (В) ОН...
1 answer
Constants Periodic Table Write the equation for the decay of Rn-222 Express your answer as a...
Constants Periodic Table Write the equation for the decay of Rn-222 Express your answer as a nuclear equation. - ALC * o O ? Submit Request Answer Part C If a room contains 25000 atoms of radon-222, how many atoms of radon-222 remain after 15.2 d ? Express your answer using two significant figures. ...
1 answer
2. Cache hierarchy You are building a computer system with in-order execution that runs at 1...
2. Cache hierarchy You are building a computer system with in-order execution that runs at 1 GHz and has a CPI of 1, with no memory accesses. The memory system is a split L1 cache. Both the I-cache and the D-cache are direct mapped and hold 32 KB each, with a block size of 64 bytes. The memory sys...
1 answer
2 (28 points) Dan's Dairy produces gourmet ch Total fixed costs are $125,000 per period. m...
2 (28 points) Dan's Dairy produces gourmet ch Total fixed costs are $125,000 per period. m ese. Each pound of cheese sells for $8 and has a variable cost of Show all supporting calculations. Compute the unit contribution margin Compute the contribution margin ratio If sales revenue for the firm ...
1 answer
Show all of these steps to work this problem: 4x6 6r3 Domain Analyses Asymptotes: Vertical Horizontal...
Show all of these steps to work this problem: 4x6 6r3 Domain Analyses Asymptotes: Vertical Horizontal Slant Intercepts х-int у-int Symmetry (Even/Odd) Continuity CALCULS Stuff 1st Derivative FDT Matrix Intervals Sign ot x) Interval Conclusion Extrema Conclusion (s) Differentiability Ran...
1 answer
What evidence is utilized by the auditor for analytical purposes in substantiating the completeness of the...
What evidence is utilized by the auditor for analytical purposes in substantiating the completeness of the allowance for bad debt estimate? a. Confirmations returned without exception. b. Copies of checks received from customers. c. Stock prices of customer companies. d. Accounts...
1 answer
Ratio Analysis The following information was taken from Logsden Manufacturing's trial balances as of December 31,...
Ratio Analysis The following information was taken from Logsden Manufacturing's trial balances as of December 31, 2010, and December 31, 2011 Accounts receivable Accounts payable Cost of Goods Sold Sales 12/31/2011 12/31/2010 $ 13,000 $ 17,000 22,000 15,000 140,000 119,000 274,000 239,000 12,000...
1 answer
Why is the hot fluid often put on the tube side rather than the shell side?...
why is the hot fluid often put on the tube side rather than the shell side? Is there any reason you may want to pass a cold fluid through the tubes rather than the shell? (This is a shell and tube heat exchanger question)...
1 answer
Assignment (Must be completed and submitted prior to your lab3 session) Create a do-while loop that...
Assignment (Must be completed and submitted prior to your lab3 session) Create a do-while loop that displays a random number on the screen, and then displays a message (in a new line) asking the user if he wishes to see another random number. If the user responds with a 'y' or a ‘Y'...
1 answer
The function x - (6.3 m) cos[(47rad/s)t + z/5 rad] gives the simple harmonic motion of...
The function x - (6.3 m) cos[(47rad/s)t + z/5 rad] gives the simple harmonic motion of a body. At t = 5.9 s, what are the (a) displacement, (b) velocity, (c) acceleration, and (d) phase of the motion? Also, what are the (e) frequency and (f) period of the motion? i (a) Number Units i (b) Number Unit...
1 answer
Given the information what is the answer to #2 NAME DATE CLASS TEACHER SUPPORT Energy Densities...
given the information what is the answer to #2 NAME DATE CLASS TEACHER SUPPORT Energy Densities of Organic Fuels Students carry out an investigation to determine how much stored energy is in fuel samples. They determine the amount of heat released from burning the fuel. Expected Outcome Fuel samples...